View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18310_low_1 (Length: 237)
Name: NF18310_low_1
Description: NF18310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18310_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 26611112 - 26610905
Alignment:
| Q |
13 |
gcagagaaagtttatgcatgtgtgttgtgtacagagtgaaaaatattaatttaa-gttttaatttgaccttactccttttcctatgccgtgtcttttgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26611112 |
gcagagaaagtttatgcatgtgtgttgtgtacagagtgaaaaatattaatttaaagttttaatttgaccttactccttttcctatgccgtgtcttttgtt |
26611013 |
T |
|
| Q |
112 |
ggttaattatattttgattacagacacatgtgcttgagtaattaactcaaccaatcatattactctttttattgctttatgatgggaccatagtatatcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26611012 |
ggttaattatattttgattacagacacatgtgcttgagtaattaactcaaccaatcatattactctttttattgctttatgatgggaccatagtatatcc |
26610913 |
T |
|
| Q |
212 |
caccacat |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
26610912 |
caccacat |
26610905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University