View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18311_high_7 (Length: 249)
Name: NF18311_high_7
Description: NF18311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18311_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 30503071 - 30502842
Alignment:
| Q |
8 |
agtcctcatggttttgtcttaagttacaaagggactcggtgagttgagaagagtgagnnnnnnnataaaagaaatgcgagactttttggtgtactagaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30503071 |
agtcctcatggttttgtcttaagttacaaagggactcggtgagttgagaagagtgagtttttttataaaagaaatgcgagactttttggtgtactagaag |
30502972 |
T |
 |
| Q |
108 |
ccaatttgaggctaaagggcttatcggctctttgtatggcttagaccgtgtaatacttcgtgtgtggcttaggctctcctagccttaaaattttgatctc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30502971 |
ccaatttgaggctaaagggcttatcggctctttgtatggcttagaccgtgtaatacttcgtgtgtggcttaggctctcctagccttaaaatttcgatctc |
30502872 |
T |
 |
| Q |
208 |
aactctgctgcgccgcttatttgagatatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30502871 |
aactctgctgcgccgcttatttgagatatt |
30502842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University