View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18311_high_8 (Length: 245)
Name: NF18311_high_8
Description: NF18311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18311_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 5116743 - 5116521
Alignment:
| Q |
10 |
ttatacttctgaaaattatattagacgatgatggtttggctcgtgtttgtgctacaacagagaannnnnnnggagtatgtcgagttttgaacatgatgtt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5116743 |
ttataattctgaaaattatattagacgatgatggtttggctcgtgtttgtgctacaacagagaatttttttggagtatgtcgagttttgaacatgatgtt |
5116644 |
T |
 |
| Q |
110 |
ggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgcttatctcaaaattacaggttggttgagaagttccat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5116643 |
ggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgtttatctcaaaattacaggttggttgagaagttccat |
5116544 |
T |
 |
| Q |
210 |
gatcttaagaatggttgaatatg |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5116543 |
gatcttaagaatggttgaatatg |
5116521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University