View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18311_high_9 (Length: 238)
Name: NF18311_high_9
Description: NF18311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18311_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 27820156 - 27820365
Alignment:
| Q |
16 |
atatctaatgaagacatggctatgttaaacaaaacattaattctgttatatttaatgagggcaaaatcattgttggcctaactttgtttccctaattgca |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27820156 |
atatctaatgaagacaacgctatgttaaacaaaacattaattctgttatatttaatgagggcaaaatcattgttggcctaactttgtttccctaattgca |
27820255 |
T |
 |
| Q |
116 |
tatttattatttattacttgtttaaaaagcgagcgaaaactttcaaccaccatctatctatctatctatctcaaatattggtaagtgtcattgctaactc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27820256 |
tatttattatttattacttgtttaaaaagcgagcgaaaactttcaaccaccatctatctatctatctatctcaaatattggtaagtgtcattgctaactc |
27820355 |
T |
 |
| Q |
216 |
tgccgttttc |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
27820356 |
tgccgttttc |
27820365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University