View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18312_high_15 (Length: 238)
Name: NF18312_high_15
Description: NF18312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18312_high_15 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 74 - 214
Target Start/End: Complemental strand, 45364 - 45224
Alignment:
| Q |
74 |
atagtgacagaatttcaagatcgggaacatgtccacctaaaattcctaatccaacagagctaaactttttcaactttccaccaatacatgcaactatctc |
173 |
Q |
| |
|
||||||| ||||||||||||| |||||||| |||| ||||||||||||||||| ||||||||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
45364 |
atagtgatagaatttcaagattgggaacatatccagctaaaattcctaatccagcagagctaaactttttccactttccatcaatacatgcgactatctc |
45265 |
T |
 |
| Q |
174 |
aacagaatcatcatacatgagctgagattgagttgttatat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264 |
aacagaatcatcatacatgagctgagattgagttgttatat |
45224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 41922908 - 41922820
Alignment:
| Q |
140 |
ttttcaactttccaccaatacatgcaactatctcaacagaat-------catcatacatgagctgagattgagttgttatattactttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
41922908 |
ttttcaactttccaccaatacatgcaaccatctcaactgaatcatcatccatcatacatgagctgagattgagatgttctattactttc |
41922820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 74 - 136
Target Start/End: Complemental strand, 41922995 - 41922933
Alignment:
| Q |
74 |
atagtgacagaatttcaagatcgggaacatgtccacctaaaattcctaatccaacagagctaa |
136 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
41922995 |
atagtgacagaatttcaagattgggaacatgtccagctaaaatccctaatccagcagagctaa |
41922933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University