View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18312_low_10 (Length: 283)
Name: NF18312_low_10
Description: NF18312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18312_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 256
Target Start/End: Original strand, 31028462 - 31028705
Alignment:
| Q |
12 |
tattctcgctggtttgtctttttcctgttccatatttttgttattcttgttgtttcatacgctcacgatgnnnnnnnnnnnnnnnnnnnnnnnnnaatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
31028462 |
tattctcgctggtttgtctttttcctgttccatatttttgttattcttcttgtttcatacgctcacgatgtttttctcttttttattttatttttaatgt |
31028561 |
T |
|
| Q |
112 |
gtattggatttgccatagttattattagtcatacttaattttgggattagtgattgaattatatttatttgcatgattagaaagaacaagtattttaatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028562 |
gtattggatttgccatagttattattagtcatacttaatttttgg-ttagtgattgaattatatttatttgcatgattagaaagaacaagtattttaatt |
31028660 |
T |
|
| Q |
212 |
gtgtcttaattctgcgtgttgtcctgattcttgatattgcgaaaa |
256 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31028661 |
gtgtcttaattctgcgtgtcgtcctgattcttgatattgcgaaaa |
31028705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 31015845 - 31015881
Alignment:
| Q |
13 |
attctcgctggtttgtctttttcctgttccatatttt |
49 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
31015845 |
attcttgctggtttgtctttttcttgttccatatttt |
31015881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University