View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18312_low_14 (Length: 241)
Name: NF18312_low_14
Description: NF18312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18312_low_14 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 4 - 241
Target Start/End: Complemental strand, 46885 - 46651
Alignment:
| Q |
4 |
aatatggtttacttggttttaaattttcatgatagtgttgcaaattattatatcattttctacctcactaaatcgagactccaacttacaagttagcaaa |
103 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||| |
|
|
| T |
46885 |
aatatggtttacttggtttttaattttcatgatagtgttgcaaattattatatcattttctacctcactaaatcgggactccaactcacaagttagtaaa |
46786 |
T |
 |
| Q |
104 |
aaggaagagaattctaaagcttttattttatgggagagattgaaaaccgatattgtgcatttagaacttggaggataaataataacttaggattgggata |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
46785 |
aaggaagagaattctaaagcttttattttatggaagagattgaaaactgatattgtgcatttagaacttggaggata---aaaaacttaggattgggata |
46689 |
T |
 |
| Q |
204 |
aagtatcgtgaaatcaatagttgaaatgaacgaacact |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
46688 |
aagtatcatgaaatcaatagttgaaatgaatgaacact |
46651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University