View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18312_low_16 (Length: 238)

Name: NF18312_low_16
Description: NF18312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18312_low_16
NF18312_low_16
[»] scaffold0050 (1 HSPs)
scaffold0050 (74-214)||(45224-45364)
[»] chr8 (2 HSPs)
chr8 (140-221)||(41922820-41922908)
chr8 (74-136)||(41922933-41922995)


Alignment Details
Target: scaffold0050 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 74 - 214
Target Start/End: Complemental strand, 45364 - 45224
Alignment:
74 atagtgacagaatttcaagatcgggaacatgtccacctaaaattcctaatccaacagagctaaactttttcaactttccaccaatacatgcaactatctc 173  Q
    ||||||| ||||||||||||| |||||||| |||| ||||||||||||||||| ||||||||||||||||| |||||||| |||||||||| ||||||||    
45364 atagtgatagaatttcaagattgggaacatatccagctaaaattcctaatccagcagagctaaactttttccactttccatcaatacatgcgactatctc 45265  T
174 aacagaatcatcatacatgagctgagattgagttgttatat 214  Q
    |||||||||||||||||||||||||||||||||||||||||    
45264 aacagaatcatcatacatgagctgagattgagttgttatat 45224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 41922908 - 41922820
Alignment:
140 ttttcaactttccaccaatacatgcaactatctcaacagaat-------catcatacatgagctgagattgagttgttatattactttc 221  Q
    |||||||||||||||||||||||||||| |||||||| ||||       |||||||||||||||||||||||| |||| ||||||||||    
41922908 ttttcaactttccaccaatacatgcaaccatctcaactgaatcatcatccatcatacatgagctgagattgagatgttctattactttc 41922820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 74 - 136
Target Start/End: Complemental strand, 41922995 - 41922933
Alignment:
74 atagtgacagaatttcaagatcgggaacatgtccacctaaaattcctaatccaacagagctaa 136  Q
    ||||||||||||||||||||| ||||||||||||| ||||||| ||||||||| |||||||||    
41922995 atagtgacagaatttcaagattgggaacatgtccagctaaaatccctaatccagcagagctaa 41922933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University