View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18312_low_17 (Length: 214)
Name: NF18312_low_17
Description: NF18312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18312_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 26 - 208
Target Start/End: Complemental strand, 6883345 - 6883176
Alignment:
| Q |
26 |
agacagttcgaacctctcaagctacatgtacccggtaccgtacccagtactcgttgcgtattgtgggcacnnnnnnnnctattatattgtatattcttta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6883345 |
agacagttcgaacctctcaagctacatgtacccggtac------------tcgttgcgtattgtgggcacttttttt-ctattatattgtatattcttta |
6883259 |
T |
 |
| Q |
126 |
ccaaattttcactctgtaaacagcatttatcaacctcctgttatgtaaataccctctttctattctaatcttcttgatgatgt |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6883258 |
ccaaattttcactatgtaaacagcatttatcaacctcctgttatgtaaataccctctttctattctaatcttcttgattatgt |
6883176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University