View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18313_high_17 (Length: 366)
Name: NF18313_high_17
Description: NF18313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18313_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 352
Target Start/End: Original strand, 29847517 - 29847850
Alignment:
| Q |
19 |
tgaatgttccacttttggcatagcttcattgaagataatataacacttaattgagatgataaagtgaagccattgtggcctctagtgaacataaggatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29847517 |
tgaatgttccacttttggcatagcttcattgaagataacataacacttaattgagatgataaagtgaagccattgtgtcctctagtgaacataaggatgg |
29847616 |
T |
 |
| Q |
119 |
actgacaactattatgtctgcttgattaaaggtggcagccctggtatgagggttactgctgctgtctaccaaacatgtcatgataccatgtcattgtttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847617 |
actgacaactattatgtctgcttgattaaaggtggcagccctggtatgagggttactgctgctgtctaccaaacatgtcatgataccatgtcattgtttt |
29847716 |
T |
 |
| Q |
219 |
tgatcttgtctgatatttaaggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaactttttattggggaacatgattttaaacaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
29847717 |
tgatcttgtctgatatttaaggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaacttgttattggggaacatgattttaaaccac |
29847816 |
T |
 |
| Q |
319 |
ggttaaggttacgatgcaaacttttatattgcag |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29847817 |
cgttaaggttacgatgcaaacttttatattgcag |
29847850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University