View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18313_high_25 (Length: 262)
Name: NF18313_high_25
Description: NF18313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18313_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 17 - 141
Target Start/End: Original strand, 33782139 - 33782263
Alignment:
| Q |
17 |
attaaccactcatgataaacctaaacatagaccgtgagtctacgaagaacaatacacgaataagtgatgatccgaaagatgaagtcttgttacaggcgta |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| | || || |
|
|
| T |
33782139 |
attaaccactcatgataaatctaaacatagaccgtgagtctacgaagaacaatacaggaataagtgatgatccaaaagatgaagtcttgttcccggtata |
33782238 |
T |
 |
| Q |
117 |
tccaatatgcttcagccttcaagaa |
141 |
Q |
| |
|
| ||||||||| || |||||||||| |
|
|
| T |
33782239 |
ttcaatatgctccaaccttcaagaa |
33782263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 171 - 252
Target Start/End: Original strand, 33782264 - 33782345
Alignment:
| Q |
171 |
atccaaaatcgacctatttgaaagtgttactcgatgccttttataaattttcgaatctcaatgattcaaaaacgggcctatg |
252 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33782264 |
atccaaaatcgacccctttggaagtgttacttgatgccttttataaattttcgaatctcagtgattcaaaaacgggcctatg |
33782345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University