View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18313_low_16 (Length: 376)
Name: NF18313_low_16
Description: NF18313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18313_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 93 - 361
Target Start/End: Original strand, 4871721 - 4871992
Alignment:
| Q |
93 |
gtaaagaccgcaacaagggttcatctttgtgttgaatttcaagttagggcagannnnnnnnnnnnnnnncagaactagggttcatcttctttctcactat |
192 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4871721 |
gtaaagaccgcaacaagggttcctctttgtgttgaatttcaagttagggcagattttatttttgtttttcagaactagggttcatcttctttctcactat |
4871820 |
T |
 |
| Q |
193 |
cacgaa---gcaacaatgctctcaatgttaagaagaagatgtgttggtggtgttagtgctgtttcttctattattactatttccaaaaacaacaagaagt |
289 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
4871821 |
cacgaattagcaacaatgctctcaatgttaagaagaagatgtgttggtggtgttagtgctgtttcttctattattactatttccaaaaacaccaacaagt |
4871920 |
T |
 |
| Q |
290 |
tgtttcctcgtcacccttatacttgtgatccattcatagacatgcctcctcttcctcgtcctccttgttact |
361 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4871921 |
tgtttcctcgtcgcccttatacttgtgatccattcatagacatgcctcctcttcctcgtcctccttgttact |
4871992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University