View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18314_high_14 (Length: 271)
Name: NF18314_high_14
Description: NF18314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18314_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 13122031 - 13122270
Alignment:
| Q |
14 |
atcacattctaaaacactttttccttttggtgtttaaaacttgcagccagtgcgcgagatgcatttcctagagattcatcactttcactgagatcatttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13122031 |
atcacattctaaaacactttttccttctggtgtttaaaacttgcagccagtgcgcgagatgcatttcctagagattcatcactttcactgagatcatttg |
13122130 |
T |
 |
| Q |
114 |
gcagtggtaacggtcaaagcagtggctcagaatccaaattttctgccgatgagaaatatggttcaacgcattcttcaactgccatggactatcagagtta |
213 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13122131 |
gcagtggtaacggtgaaagcagtggctcagaatccaaattttctgccgatgagaaatatggttcaacgcattcttcaactgctatggactatcagagtta |
13122230 |
T |
 |
| Q |
214 |
tacttctgtgatagatgttatggatgatagcactgatgac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13122231 |
tacttctgtgatagatgttatggatgataccactgatgac |
13122270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University