View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18314_low_17 (Length: 260)
Name: NF18314_low_17
Description: NF18314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18314_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 18319990 - 18319735
Alignment:
| Q |
1 |
ctagaggtccatagatttgaggaaaagacgacaggtatacatagaatcaaacaaattgcgacgcgcgtcaattttgaaaccaaataaataacaataacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319990 |
ctagaggtccatagatttgaggaaaagacgacaggtatacatagaatcaaacaaattgcgacgcgcgtcaattttgaaaccaaataaataacaataacaa |
18319891 |
T |
|
| Q |
101 |
tatcaactaccattatcaaattgcctcaaattaatctcattcacgaattcacaaacacacagaaaaatatgggcgtggtgataatcgacggcaccaccgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319890 |
tatcaactaccattatcaaattgcctcaaattaatctcattcacgaattcacaaacacacagaaaaatatgggcgtggtgataatcgacggcaccaccgt |
18319791 |
T |
|
| Q |
201 |
gcgagacttcatcgccgacgatacacatttcacaaacagcatcaacgaacaattca |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319790 |
gcgagacttcatcgccgacgatacacatttcacaaacagcatcaacgaacaattca |
18319735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University