View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18315_high_35 (Length: 389)

Name: NF18315_high_35
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18315_high_35
NF18315_high_35
[»] chr5 (3 HSPs)
chr5 (135-340)||(37498428-37498655)
chr5 (12-58)||(37498731-37498777)
chr5 (336-371)||(37498381-37498416)
[»] chr4 (1 HSPs)
chr4 (267-338)||(42602944-42603015)
[»] chr1 (1 HSPs)
chr1 (14-47)||(31321195-31321228)


Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 135 - 340
Target Start/End: Complemental strand, 37498655 - 37498428
Alignment:
135 ctttggttcttccatcgtctttcttcctctattttcatcttactttcaccatttcttctagctatgtcctccatttatgctaaa---------------- 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                    
37498655 ctttggttcttccatcgtctttcttcctctattttcatcttactttcaccatttcttctagctatgtcctccatttatgctaaaaattcacaaatagatc 37498556  T
219 ------ctgtaaaatttccatgattttcacaaacacatgcttcttttgcacattgattttgacaaggttgtggacgatgatgaaattgtcactgcattga 312  Q
          |||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
37498555 ataaaactgtaaaattcccatgattttcacaaaaacatgcttcttttgcacatcgattttgacaaggttgtggacgatgatgaaattgtcactgcattga 37498456  T
313 ggcttttaaaccaggttaccccaatttc 340  Q
    ||||||||||||||||||||||||||||    
37498455 ggcttttaaaccaggttaccccaatttc 37498428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 12 - 58
Target Start/End: Complemental strand, 37498777 - 37498731
Alignment:
12 gcgccgctaatttggcaaattggatgatgagtcacattgtgagaggg 58  Q
    |||||||| ||||||||||||||||||||||||||| ||||||||||    
37498777 gcgccgctgatttggcaaattggatgatgagtcacaatgtgagaggg 37498731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 371
Target Start/End: Complemental strand, 37498416 - 37498381
Alignment:
336 atttcacatcgaatgagatgttgttgacgacttttg 371  Q
    ||||||||||||||||||||||||||||||||||||    
37498416 atttcacatcgaatgagatgttgttgacgacttttg 37498381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 267 - 338
Target Start/End: Complemental strand, 42603015 - 42602944
Alignment:
267 gattttgacaaggttgtggacgatgatgaaattgtcactgcattgaggcttttaaaccaggttaccccaatt 338  Q
    |||||||||| ||| ||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||    
42603015 gattttgacagggtggtggatgatgatgaaactgtcactgcattgaggcttctaaaccaggttaccccaatt 42602944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 31321195 - 31321228
Alignment:
14 gccgctaatttggcaaattggatgatgagtcaca 47  Q
    |||||| |||||||||||||||||||||||||||    
31321195 gccgctgatttggcaaattggatgatgagtcaca 31321228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University