View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_51 (Length: 337)
Name: NF18315_high_51
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 13 - 155
Target Start/End: Complemental strand, 1701049 - 1700897
Alignment:
| Q |
13 |
atgaacgggatcggaatattaggaacaaaagtcgcatagtgatctccg---------caaattgtaatnnnnnnnn-ctgtacaaatgaacttccaactt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1701049 |
atgaacgggatcggaatattaggaacaaaagtcgcatagtgatctccgaaaattccgcaaattgtaataaaaaaaaactgtacgaatgaacttccaactt |
1700950 |
T |
 |
| Q |
103 |
ccaagtatgacaaatcttgacttattaatcacaaatcacaatatgaatatgaa |
155 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1700949 |
ccaagtatgagaaatcttgacttattaatcacaaatcacaatatgaatatgaa |
1700897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 242 - 320
Target Start/End: Complemental strand, 1700757 - 1700679
Alignment:
| Q |
242 |
ttgttgttcttccagatctggttgatgactcttttcccgaaggtagtgatcgctccgctgctcgaattggctgccatac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1700757 |
ttgttgttcttccagatctggttgatgactcttttcccgaaggtagtgatcgatccgctgctcgaattggctgccatac |
1700679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 1700844 - 1700789
Alignment:
| Q |
155 |
aaattgaaatagcaacagtagtaattaaacaatgaatgaaaattataccttgatgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1700844 |
aaattgaaatagcaacagtagtaattaaacaatgaatgaaaattataccttgatgc |
1700789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University