View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_58 (Length: 307)
Name: NF18315_high_58
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 129 - 301
Target Start/End: Original strand, 27791876 - 27792048
Alignment:
| Q |
129 |
gatctagatccaaaaattgaggatgtgccatatgcatgaatgcggcaaatttgggactgcagggaatcctgggcatgacagtaaagttaagctttacatc |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791876 |
gatctagatccaaaaattgaggatgtgccatatgcatgaatacggcaaatttgtgactgcagggaatcctgggcatgacagtaaagttaagctttacatc |
27791975 |
T |
 |
| Q |
229 |
tgtgacagaagagttccactagatgtgaaagcaaggctaaattagttagtacatccttgtagtttcatctcac |
301 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27791976 |
tggggcagaagagttccactagatgtgaaagcaaggataaattagttagtacatccttgtagtttcatttcac |
27792048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 27791819 - 27791900
Alignment:
| Q |
17 |
catcagattcgctgcagtcacaaatttgctgcattcatgcattcagcacataagcccgatttagatccaaaaattgaggatg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27791819 |
catcagattcgctgcagtcacaaatttgccacattcatgcattcagcacataagcctgatctagatccaaaaattgaggatg |
27791900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University