View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_62 (Length: 301)
Name: NF18315_high_62
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 30852372 - 30852096
Alignment:
| Q |
18 |
ttcctttggtttgatccattactagaccaatagcttcaccaagtcaatcaatgaacccgttaaagtatgtcaaccaaagatcatcaaatttcgatgcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
30852372 |
ttcctttggtttgatccattactagaccaatagcttcaccaagtcaatcaatgaacccattaaagtatgtcacccaaagatcaccaaatttcgatgcttc |
30852273 |
T |
 |
| Q |
118 |
caaatagttcatacacaagtcaactaaatcaaatgaatttattccttcaaaacctttaaattgaaccatgtgacaaaaattattgtttgtcactgcacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30852272 |
caaatagttcatacacaagtcaactaaatcaaatgaatctattccttcaaagcctttaaattgaaccatatgacaaaaattattgtttgtcactgcacaa |
30852173 |
T |
 |
| Q |
218 |
tataatcctaactaaaacaatatattcgaaaataatttactagaaactcaacattcaaaacacatagacttcttctc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
30852172 |
tataatcctaactaaaacaatatattcgaaaataatttactagaaactcaacattcaaaacacgtatacttcttctc |
30852096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University