View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_63 (Length: 300)
Name: NF18315_high_63
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 279440 - 279157
Alignment:
| Q |
1 |
gatgtccatgaccactcgggagagtttcctaatttttgatgtagttgcttcatataaatatttgtttgtgcttccgtctttgcagtgttgtaaacttctt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
279440 |
gatgtccatgaccactcgggcgagtttcctaatttttgatctagttgcttcatataaatatttgtttgtgcttcagtctttgcagtgttgtaaacttctt |
279341 |
T |
 |
| Q |
101 |
tgttgcagtcttggagaagggacattgaccaagcagaaacataatactttccatcttgttgtaaatcaacttcagcatctttagaggtatgtgaattact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279340 |
tgttgcagtcttggagaagggacattgaccaagcaggaacataatactttccatcttgttgtaaatcaacttcagcatctttagaggtatgtgaattact |
279241 |
T |
 |
| Q |
201 |
caaaaaacaaattttttgtccagtgtccttatttgtataagtagtcatccataaataatctccatgactctcccaagtagcagt |
284 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
279240 |
caaaaaacaaaatttttgtccagtgcccttatttgtataagtagtcatccataaagaatctccatgactctcccaagtagcagt |
279157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University