View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_66 (Length: 287)
Name: NF18315_high_66
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 10 - 164
Target Start/End: Complemental strand, 3837402 - 3837248
Alignment:
| Q |
10 |
ataattctcgtgatccccccatagtatatatttttgttgctgatgaattgtttttgccctaggacacaagttcaaatattctttgaatcattgaataaat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3837402 |
ataattctcgtgatccccccatagtatatatttttgttgttggtgaattgtttttgccctaggacacaagttcaaatattctttgaatcattgaagaaat |
3837303 |
T |
|
| Q |
110 |
attcgagatatggttcttgtatggcaataaaatagttgttgactagaattcgtag |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3837302 |
attcgagatatggttcttgtatggcaataaaatagttgttgactagaattcgtag |
3837248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 211 - 274
Target Start/End: Complemental strand, 3837179 - 3837116
Alignment:
| Q |
211 |
agatagaggaactagatgtctttggtcttttggtcacatttaatgggttgagtttgttgattct |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3837179 |
agatagaggaactagatgactttggtcttttggtcacatttaatgggatgagtttgttgattct |
3837116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University