View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_67 (Length: 282)
Name: NF18315_high_67
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 167
Target Start/End: Original strand, 10799368 - 10799519
Alignment:
| Q |
18 |
tgtgtcttatgggagaaattgcgattgggcgatgagagaagaattttcgagtgagattcgagaaaaaagattaatctannnnnnnnnnnnn---agaatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
10799368 |
tgtgtcttatgggagaaattgcgattgggcgatgagagaagaatttttgagtgagattcgagaaagaagattaatccattttttttttttttttagaatt |
10799467 |
T |
|
| Q |
115 |
tcctataatgaagttagtttaagagagaaaaaatgagaaagatgacgatgaag |
167 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
10799468 |
tcctataatgaacttagtttaaga-aaaaaaaatgggaaagatgacgatgaag |
10799519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 10808529 - 10808606
Alignment:
| Q |
18 |
tgtgtcttatgggagaaattgcgattgggcgatgagagaagaattttcgagtgagattcgagaaaaaagattaatcta |
95 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
10808529 |
tgtgtcttatgggagaaattgtgcttgggcgatgggagaagaataatctagtgagattcgagaaagaagattaatcta |
10808606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University