View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_73 (Length: 257)
Name: NF18315_high_73
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 22 - 253
Target Start/End: Complemental strand, 40285028 - 40284797
Alignment:
| Q |
22 |
tcgcttactcattttatccctttgcaactatactatacctgttttgcaattttatttttaggaagagcgacattatcttcaacgggatatttctattgga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40285028 |
tcgcttactcattttatccctttgcaactatactatacctgttttgcaattttatttttaggaagagcgacattatcttcaacgggatatttctattgga |
40284929 |
T |
 |
| Q |
122 |
caatgcaaggatgctgctacgcaaacacagaatggcaaaatagatatttactggaaataccatagttcgttattatcatccaatcgtaaagaggttcctt |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40284928 |
caatgcaaggatgctgctacacaaacacagaatggaaaaatagatatttactggaaaaaccatagttcgttattatcatccaatcgtaaagaggttcctt |
40284829 |
T |
 |
| Q |
222 |
ggtatctggtgtgttggttttctctgctcctc |
253 |
Q |
| |
|
||||||||||||||||||||||| || ||||| |
|
|
| T |
40284828 |
ggtatctggtgtgttggttttctttgttcctc |
40284797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 29 - 105
Target Start/End: Complemental strand, 40272546 - 40272470
Alignment:
| Q |
29 |
ctcattttatccctttgcaactatactatacctgttttgcaattttatttttaggaagagcgacattatcttcaacg |
105 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||| || ||||| |||| |||| ||||| |||| |
|
|
| T |
40272546 |
ctcattttagtcctttgcaactatattatacctgttttgcaatttttttattaggtagaggaacatcatcttaaacg |
40272470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University