View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18315_high_78 (Length: 225)

Name: NF18315_high_78
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18315_high_78
NF18315_high_78
[»] chr6 (1 HSPs)
chr6 (18-156)||(787553-787689)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 787553 - 787689
Alignment:
18 tttttcactgataccgattcagtttcacgttcttgattcctttcttgcttcaatttcgtttttctgatctcgtgattgaggaattccttccatcgattgt 117  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
787553 tttttcactgattccgattcagtgtcacgttcttgattcctttcttatttcaatttcgtttttctgatctcgtgattgaggaattccttgcatcgattgt 787652  T
118 tcattccttattttcttttgatttagtaatttctttttc 156  Q
    ||||||||| |||||  ||||||| | ||||||||||||    
787653 tcattccttcttttc--ttgatttggcaatttctttttc 787689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University