View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_8 (Length: 667)
Name: NF18315_high_8
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 3e-31; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 575 - 660
Target Start/End: Original strand, 34420162 - 34420247
Alignment:
| Q |
575 |
tcttaaatgtaagaattgttcttctgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagatgattgatgatgt |
660 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
34420162 |
tcttaaatgtaagaattgttctaatgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagctgattgctgatgt |
34420247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 588 - 646
Target Start/End: Original strand, 34424311 - 34424369
Alignment:
| Q |
588 |
aattgttcttctgttggtctagtatttattgtgaaattgttgttcaggaaactgaggag |
646 |
Q |
| |
|
|||||||||||| |||||| |||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
34424311 |
aattgttcttctcttggtcaagtatttactatgaaattgttgttcaggaaactgaggag |
34424369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 85
Target Start/End: Original strand, 34420082 - 34420149
Alignment:
| Q |
17 |
acaatcagatgctcagtacttgtcactataaatctgttcgtgtaattttaggttatgatcatggaaatt |
85 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
34420082 |
acaatcagatgctcagtacttgtcactgtaaatctgctcacttaa-attaggttatgatcatggaaatt |
34420149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University