View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_high_82 (Length: 211)
Name: NF18315_high_82
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_high_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 36057498 - 36057691
Alignment:
| Q |
1 |
ttgattgtgcacttgcctttgatttctctcccgacacattttgggtaattcaaagtgaactacaatacttagctggaatagtgttccgtcaacgatgaac |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36057498 |
ttgattgtgcacttggctttgatttctctcccgacacattttgggtaattcaaaatgaactacaatacttagccggaatagtgttccgtcaacgatgaac |
36057597 |
T |
 |
| Q |
101 |
ttgtatctcaccatgtacaagaggaagagagggtgcagaaggataggattgaagtgttcacttgactactatctctcaaaataaaagcaaatag |
194 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36057598 |
ttgtatctcaccatgtgcaagaggaagagagggtgcagaaggataggattgaagtgttcacttgactactatctctcaaaataaaagcaaatag |
36057691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University