View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_low_38 (Length: 389)
Name: NF18315_low_38
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 135 - 340
Target Start/End: Complemental strand, 37498655 - 37498428
Alignment:
| Q |
135 |
ctttggttcttccatcgtctttcttcctctattttcatcttactttcaccatttcttctagctatgtcctccatttatgctaaa---------------- |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37498655 |
ctttggttcttccatcgtctttcttcctctattttcatcttactttcaccatttcttctagctatgtcctccatttatgctaaaaattcacaaatagatc |
37498556 |
T |
 |
| Q |
219 |
------ctgtaaaatttccatgattttcacaaacacatgcttcttttgcacattgattttgacaaggttgtggacgatgatgaaattgtcactgcattga |
312 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37498555 |
ataaaactgtaaaattcccatgattttcacaaaaacatgcttcttttgcacatcgattttgacaaggttgtggacgatgatgaaattgtcactgcattga |
37498456 |
T |
 |
| Q |
313 |
ggcttttaaaccaggttaccccaatttc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37498455 |
ggcttttaaaccaggttaccccaatttc |
37498428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 12 - 58
Target Start/End: Complemental strand, 37498777 - 37498731
Alignment:
| Q |
12 |
gcgccgctaatttggcaaattggatgatgagtcacattgtgagaggg |
58 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37498777 |
gcgccgctgatttggcaaattggatgatgagtcacaatgtgagaggg |
37498731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 371
Target Start/End: Complemental strand, 37498416 - 37498381
Alignment:
| Q |
336 |
atttcacatcgaatgagatgttgttgacgacttttg |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37498416 |
atttcacatcgaatgagatgttgttgacgacttttg |
37498381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 267 - 338
Target Start/End: Complemental strand, 42603015 - 42602944
Alignment:
| Q |
267 |
gattttgacaaggttgtggacgatgatgaaattgtcactgcattgaggcttttaaaccaggttaccccaatt |
338 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42603015 |
gattttgacagggtggtggatgatgatgaaactgtcactgcattgaggcttctaaaccaggttaccccaatt |
42602944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 31321195 - 31321228
Alignment:
| Q |
14 |
gccgctaatttggcaaattggatgatgagtcaca |
47 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
31321195 |
gccgctgatttggcaaattggatgatgagtcaca |
31321228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University