View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_low_56 (Length: 337)
Name: NF18315_low_56
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 10 - 321
Target Start/End: Original strand, 22073616 - 22073927
Alignment:
| Q |
10 |
agatgaagattcggcatgacctgttaatggcacatgtaacttgttattttgaataattatatttcttttttctctgcttagaaccgcgacctctggttgg |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||| | |||| | ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22073616 |
agatgaagattcagcatgacctgttaatggcacatctaacttgttattttgcaaaattctttttcttttttctctgcttagaactgcgacctctggttgg |
22073715 |
T |
 |
| Q |
110 |
attctgcttccatcaaattgttttggattgggcagttgaggagaatgaacacaaacttttttggatgcagcaagtgccttactttggtagagaattcttt |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22073716 |
attctgcttccattaaattgttttggattgggcagttgaggagaatgaacacaaactttttttgatgcagcaagtgccttactttggtagagaattcttt |
22073815 |
T |
 |
| Q |
210 |
tcctgttttctcttcctgctgctgcattttcatgttgaagcactgtttcattcaaattaataggtttaatgactttgagttttggtttgactttagaagt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22073816 |
tcctgttttctcttcctgctgctgcattttcatgttgaagcactgtttcattaaaattaataggtttaatgactttgagttttggtttgactttagaaat |
22073915 |
T |
 |
| Q |
310 |
tcgtgtgttaat |
321 |
Q |
| |
|
| |||||||||| |
|
|
| T |
22073916 |
tggtgtgttaat |
22073927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University