View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_low_59 (Length: 317)
Name: NF18315_low_59
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 17 - 305
Target Start/End: Complemental strand, 26828916 - 26828628
Alignment:
| Q |
17 |
agaatcctcccggccagctgctttagtatcagcagtgcgcaggccattattagaggcagttgccacactcaactgtttactgctgtttgcggttttccac |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26828916 |
agaatcctcccggccagctgttttagtatcagcagtgcgcaggccattattagaggcagttgccacactcaactgtttactgctgtttgcggttttccac |
26828817 |
T |
 |
| Q |
117 |
ccctgcagcaagtgcctcgcgtgctctggaatagtttgacagttttcagttacattttgtattttatttggttctttattgttctattggaaaaataaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
26828816 |
ccctgcagcaagtgcctcgcgtgctctggaatagtttgacagttttcagttacattttgtattttctttgattctttattggtctattggaaaaataaga |
26828717 |
T |
 |
| Q |
217 |
aacatttcattgtgtcacaatcttctccgaggatgagtatatggttattgcagattcctcatccatcacttgtcattgtataagatgat |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26828716 |
aacatttcattgtgtcacaatcttctccgaggatgagtatatggttattgcagattcctcatccatcacttgtcattgtataatatgat |
26828628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University