View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_low_64 (Length: 302)
Name: NF18315_low_64
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 24552036 - 24551939
Alignment:
| Q |
18 |
aacacaatacaatatgaagtagaattagcaacaacttttccttaaaactagcattgcgtgcgtactcttcttaactttccaacaatactatatttccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
24552036 |
aacacaatacaatatgaagtagaattagcaacaacttttccttaaaactagcattgcgtgcgtaatcttcttaactttccaacactactatatttccc |
24551939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 239 - 292
Target Start/End: Complemental strand, 24551844 - 24551791
Alignment:
| Q |
239 |
cacccacatcaagcacaaggcttgcctaataggaggacaaaatagtataatcta |
292 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
24551844 |
cacccacatcaagcgcaaggtctgcctaataggaggacaaaatagtattatcta |
24551791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University