View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_low_73 (Length: 278)
Name: NF18315_low_73
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 10426275 - 10426116
Alignment:
| Q |
1 |
cctatcccattttcccttatccttccaccctgtttttctactgtttcttctttacccttgcgttgagttttgatcgacgaaaaattgatccatggaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
10426275 |
cctatcccattttcccttatccttccaccctatttttctactgtttcttctttacccttgcgttgagttttgatcg---------------atggaaatt |
10426191 |
T |
 |
| Q |
101 |
gtcccttagctttttaaatccgctgaagaagtataggaatctgcttggaggtattattcttacattcaccgttccaattag |
181 |
Q |
| |
|
|||| |||||||||||||| |||| ||| |||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10426190 |
gtcc-----ctttttaaatccgc-gaagtagtttaggaatctgctgggaggtattattcttacattcactgttccaattag |
10426116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 209 - 273
Target Start/End: Complemental strand, 10425498 - 10425434
Alignment:
| Q |
209 |
cttaataaccgtcaaatatcttcccacatagaaacacaatataatccgcttctaattaagacttc |
273 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10425498 |
cttaataaccttcaaatatcttcccacatagaaacacaatataatccgcttctaattaagacttc |
10425434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 33 - 78
Target Start/End: Complemental strand, 37686478 - 37686433
Alignment:
| Q |
33 |
tttttctactgtttcttctttacccttgcgttgagttttgatcgac |
78 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37686478 |
tttttctaccgtttcttctttacccttgcgttgagttttgatcgac |
37686433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 2 - 168
Target Start/End: Original strand, 24819495 - 24819656
Alignment:
| Q |
2 |
ctatcccattttcccttatccttccaccctgtttttctactgtttcttctttacccttgcgttgagttttgatcgacgaaaaattgatccatggaaaatg |
101 |
Q |
| |
|
||||| ||| |||||| ||||||||||||| |||||||| |||||| ||| |||||| || |||||||||||| ||| |||||||||| | |||||||| |
|
|
| T |
24819495 |
ctatcgcatcttccctcatccttccaccctatttttctaaggtttctccttgaccctttcgctgagttttgatcaacggaaaattgatcaacggaaaatg |
24819594 |
T |
 |
| Q |
102 |
tcccttagctttttaaatccgctgaagaagtataggaatctgcttggaggtattattcttacattca |
168 |
Q |
| |
|
||| ||||||||||||||| ||||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
24819595 |
tcc-----ctttttaaatccgctcaagaagtttaggaatctgctgcgaggtattattcttatattca |
24819656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 33 - 75
Target Start/End: Original strand, 7497263 - 7497305
Alignment:
| Q |
33 |
tttttctactgtttcttctttacccttgcgttgagttttgatc |
75 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7497263 |
tttttctaccgtttcttctttacccttgcgttgagttttgatc |
7497305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 120 - 181
Target Start/End: Complemental strand, 18940976 - 18940915
Alignment:
| Q |
120 |
ccgctgaagaagtataggaatctgcttggaggtattattcttacattcaccgttccaattag |
181 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
18940976 |
ccgctgaagaagatcaggaatctgcaaagaggtattattcttacaatcacccttccaattag |
18940915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University