View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_low_76 (Length: 269)
Name: NF18315_low_76
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_low_76 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 3825429 - 3825696
Alignment:
| Q |
1 |
tgatgacttttagctattggtcccatataaaattgatgtgattttaattaaagacgggtcagatttattccaaaataacattccgtagcctatagatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3825429 |
tgatgacttttagctattggtcccatatgaaattgatgtgattttaattaaagacggatcagatttattccaaaataacattccgtagcctatagatgca |
3825528 |
T |
|
| Q |
101 |
attttggtatcacatcttatgtcctaattttggtataatggctcccggccaagggcacaccacctagtctatccatttggataaagtttacatattaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3825529 |
attttggtatcacatcttatgtcctaattttggtataatggct-ccggccaagggcacaccacctagtctatccatttggataaagtttacatattaatg |
3825627 |
T |
|
| Q |
201 |
gaacnnnnnnngacatatgttaatttataatggaattaaacttttttgacaagccatgttactgataat |
269 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3825628 |
gaacaaaaaaagacatatgttaatttataatggaattaaacttttttgacaagccatgttactgataat |
3825696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University