View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18315_low_83 (Length: 225)
Name: NF18315_low_83
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18315_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 787553 - 787689
Alignment:
| Q |
18 |
tttttcactgataccgattcagtttcacgttcttgattcctttcttgcttcaatttcgtttttctgatctcgtgattgaggaattccttccatcgattgt |
117 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
787553 |
tttttcactgattccgattcagtgtcacgttcttgattcctttcttatttcaatttcgtttttctgatctcgtgattgaggaattccttgcatcgattgt |
787652 |
T |
 |
| Q |
118 |
tcattccttattttcttttgatttagtaatttctttttc |
156 |
Q |
| |
|
||||||||| ||||| ||||||| | |||||||||||| |
|
|
| T |
787653 |
tcattccttcttttc--ttgatttggcaatttctttttc |
787689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University