View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18316_low_13 (Length: 249)
Name: NF18316_low_13
Description: NF18316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18316_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 39123582 - 39123360
Alignment:
| Q |
14 |
gaacacagagttacacgccttaaaatgagtagcatatttaaacagtttcattcttctcccttataaatccaaaggaactgatttgaccctgcttttttct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39123582 |
gaacacagagttacacgccttaaaatgagtagcatatttaaacagtttcattcttctcccttataaatccaaaggaactgatttgaccctgcttttttct |
39123483 |
T |
|
| Q |
114 |
tttgtaagatattaaaccaagtcaaattgaataaaatgatggccatgtctcactactactctccctatgactgttactacttactatcaacgtgattggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39123482 |
tttgtaagatattaaaccaagtcaaattgaataaaatgatggccatgtctcactactactctccctatgactgttactacttactatcaacgtgattggg |
39123383 |
T |
|
| Q |
214 |
cattgacaagcaagacacaggtt |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39123382 |
cattgacaagcaagacacaggtt |
39123360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University