View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18316_low_14 (Length: 209)

Name: NF18316_low_14
Description: NF18316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18316_low_14
NF18316_low_14
[»] chr4 (6 HSPs)
chr4 (20-97)||(7793227-7793304)
chr4 (24-88)||(7772721-7772785)
chr4 (20-88)||(7778495-7778564)
chr4 (20-93)||(7909571-7909644)
chr4 (154-195)||(7793083-7793124)
chr4 (154-194)||(7778374-7778414)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 9e-32; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 7793304 - 7793227
Alignment:
20 gacataatggacatgttggttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgtcattggttt 97  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
7793304 gacataatgggcatgttggttgttggttttcttgaccgattctatcttttttgtttgtatctttggtgtcattggttt 7793227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 7772785 - 7772721
Alignment:
24 taatggacatgttggttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgt 88  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
7772785 taatgggcatgttggttgttggttttcatgaccgattctatcttttttgtttgtatatttggtgt 7772721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 7778564 - 7778495
Alignment:
20 gacataatggacatgttgg-ttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgt 88  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||    
7778564 gacataatgggcatgttgggttgttggttttcatgaccgattctatcttttttgtttgtatatttggtgt 7778495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 7909571 - 7909644
Alignment:
20 gacataatggacatgttggttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgtcattg 93  Q
    |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||    
7909571 gacataattggcatgttggttgttggttttcatgaccgattctatcttttttgtttgtttcttcggtttcattg 7909644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 7793124 - 7793083
Alignment:
154 cttcctttgagatatgttaaaatgtcactcacactccctttg 195  Q
    ||||||||||||||| |||||||||||||||||| |||||||    
7793124 cttcctttgagatatattaaaatgtcactcacaccccctttg 7793083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 7778414 - 7778374
Alignment:
154 cttcctttgagatatgttaaaatgtcactcacactcccttt 194  Q
    |||||||| |||||||| |||||||||||||||||||||||    
7778414 cttcctttaagatatgtcaaaatgtcactcacactcccttt 7778374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University