View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18316_low_14 (Length: 209)
Name: NF18316_low_14
Description: NF18316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18316_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 9e-32; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 7793304 - 7793227
Alignment:
| Q |
20 |
gacataatggacatgttggttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgtcattggttt |
97 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7793304 |
gacataatgggcatgttggttgttggttttcttgaccgattctatcttttttgtttgtatctttggtgtcattggttt |
7793227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 7772785 - 7772721
Alignment:
| Q |
24 |
taatggacatgttggttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgt |
88 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7772785 |
taatgggcatgttggttgttggttttcatgaccgattctatcttttttgtttgtatatttggtgt |
7772721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 7778564 - 7778495
Alignment:
| Q |
20 |
gacataatggacatgttgg-ttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgt |
88 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7778564 |
gacataatgggcatgttgggttgttggttttcatgaccgattctatcttttttgtttgtatatttggtgt |
7778495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 7909571 - 7909644
Alignment:
| Q |
20 |
gacataatggacatgttggttgttggttttcatgaccgattctatcttttttgtttgtatctttggtgtcattg |
93 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
7909571 |
gacataattggcatgttggttgttggttttcatgaccgattctatcttttttgtttgtttcttcggtttcattg |
7909644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 7793124 - 7793083
Alignment:
| Q |
154 |
cttcctttgagatatgttaaaatgtcactcacactccctttg |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
7793124 |
cttcctttgagatatattaaaatgtcactcacaccccctttg |
7793083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 7778414 - 7778374
Alignment:
| Q |
154 |
cttcctttgagatatgttaaaatgtcactcacactcccttt |
194 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7778414 |
cttcctttaagatatgtcaaaatgtcactcacactcccttt |
7778374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University