View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18316_low_9 (Length: 286)
Name: NF18316_low_9
Description: NF18316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18316_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 13 - 154
Target Start/End: Original strand, 37021330 - 37021471
Alignment:
| Q |
13 |
aaaattgcaccatgaattgtcaagattgtatcacgatcttctactcgtgcccaatattgctgccagccttatccaaaattgtgccactattccttctgat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37021330 |
aaaattgcaccatgaattgtcaagattgtgtcacgatcttcaactcgtacccaatattgctgtcagccttatccaaaattgtgccactattccttctgat |
37021429 |
T |
 |
| Q |
113 |
cgtggcacannnnnnnacgaaccaaatcaatatctcagaacc |
154 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| |
|
|
| T |
37021430 |
cgtggcacgtttttttacgaaccaaatcaatatctcaaaacc |
37021471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 192 - 270
Target Start/End: Original strand, 37021932 - 37022010
Alignment:
| Q |
192 |
acctaacttcaaattattataactacattcccttagaaaccaggaagaaaactctcatgctaggtttatgtttaattat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37021932 |
acctaacttcaaattattataactacattcccttagaaaccaggaagaaaactctcatgctaggtttatgtttaattat |
37022010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 192 - 233
Target Start/End: Original strand, 37033753 - 37033794
Alignment:
| Q |
192 |
acctaacttcaaattattataactacattcccttagaaacca |
233 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
37033753 |
acctaactccaaatttttataactacattcccttagaaacca |
37033794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University