View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18317_high_104 (Length: 238)

Name: NF18317_high_104
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18317_high_104
NF18317_high_104
[»] chr6 (1 HSPs)
chr6 (115-232)||(1273566-1273683)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 115 - 232
Target Start/End: Complemental strand, 1273683 - 1273566
Alignment:
115 ttttgttggatacgtatgagatattttacggatatacacaaacacttattttaagattgatggatgacacgaaaaaaggcatgatatgattgtagtatat 214  Q
    |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||    
1273683 ttttattggatacgtatgagatactttacggatatacacaaacacttattttaagattgatggatgacacaaaaaaaggcaagatatgattgtagtatat 1273584  T
215 caatggatatgtataaga 232  Q
    ||||||||||||||||||    
1273583 caatggatatgtataaga 1273566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University