View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_high_115 (Length: 227)
Name: NF18317_high_115
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_high_115 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 2369005 - 2369220
Alignment:
| Q |
1 |
tttaagcatggaaaatttggcaaaagatggaagtgatacaggggcaaatat-----------atatgcaactttgagcatgatcatggatgctaaatttt |
89 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2369005 |
tttaagcatggaaaatttggcaaacgatggaagtgatacaggggcaaatatattaagtatatatatgcaactttgagcatgatcatggatgctaaatttt |
2369104 |
T |
|
| Q |
90 |
tagattaataataatgtatgctaattgctg-ttagcaacatatatagttttgaatttcagttggatgtttgcaatgaacaattattgttgtatgtatatg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2369105 |
tagattaataataatgtatgctaattgctgtttagcaacatatatagttttgaatttcagttggatgtttgcaatgaacaattattgttgtatgtatatg |
2369204 |
T |
|
| Q |
189 |
-aagcccttaacttta |
203 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2369205 |
aaagcccttaacttta |
2369220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 115
Target Start/End: Original strand, 2365550 - 2365663
Alignment:
| Q |
4 |
aagcatggaaaatttggcaaaagatggaagtgatacaggggcaaatatat-----atgcaactttgagcatgatcatggatgctaaatttttagattaat |
98 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| ||| ||| ||||||| || ||||||||||||||||||| ||||| |||| |||||| ||| |
|
|
| T |
2365550 |
aagcatggaaaattcggcaagggatggaagtgatgcagaggcgaatatattaaatatccaactttgagcatgatcatcaatgctgaattattagatgaat |
2365649 |
T |
|
| Q |
99 |
aataatgtatgctaatt |
115 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
2365650 |
a---atgtatgctaatt |
2365663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University