View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_high_46 (Length: 372)
Name: NF18317_high_46
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_high_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 68 - 355
Target Start/End: Original strand, 8793630 - 8793918
Alignment:
| Q |
68 |
tccattcttaacatcatagtactaaataaattgagatgcatttaagaggtcgatatctctcaacatgattttttatatacaatannnnnnn-atcagtta |
166 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
8793630 |
tccactcttaacatcatagtactaaataaattgagatacatttaagaggtcgatatctctcaacatgattttttatatataatattttttttatcagtta |
8793729 |
T |
|
| Q |
167 |
tactctttctctatcaattactttataattatttaaagacaggagtatatgtttaaaatttgcttattaatcaaaacatannnnnnnggaaaaacaatct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8793730 |
tactctttctctatcaattactttataattattaaaagacaagagtatatgtttaaaatttgcttattaatcaaaacatatttttttggaaaaacaatct |
8793829 |
T |
|
| Q |
267 |
attaagtacatagcaacatagagagtatactttgcaagagcgatataatggttggttgttcaggtgtttgacctttcgttcattcactg |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8793830 |
attaagtacatagcaacatagagagtatactttgcaagagccatataatggttgtttgttcaggtgtttgacctttcgttcattcactg |
8793918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University