View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_high_59 (Length: 321)
Name: NF18317_high_59
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 168 - 302
Target Start/End: Original strand, 2851059 - 2851193
Alignment:
| Q |
168 |
aaacttcacaagacttttacaatttttgtaaacaacaccattccaacgtagaattttcagaaccggaaaattaaaatcgaaatctcttacgattatcttt |
267 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2851059 |
aaacttcacaagacttttacgatttttgtaaagaacaccattccaacgtagaattttcagaaccggaaaattaaaatcgaaatctcttacgattatcttt |
2851158 |
T |
 |
| Q |
268 |
ttcaaatgcagaacttgaagattcatacaagtaaa |
302 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2851159 |
ttcaaattcagaacttgaagattcatacaagtaaa |
2851193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University