View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18317_high_75 (Length: 298)

Name: NF18317_high_75
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18317_high_75
NF18317_high_75
[»] chr8 (3 HSPs)
chr8 (111-244)||(10388647-10388780)
chr8 (16-52)||(10388552-10388588)
chr8 (239-281)||(10388795-10388837)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 111 - 244
Target Start/End: Original strand, 10388647 - 10388780
Alignment:
111 gagaattatggagttaggaagttggaaggtgtttttgctattttcattggaactatgggtctttcctttgcatggatgttctttgatacaaagccaagtg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10388647 gagaattatggagttaggaagttggaaggtgtttttgctattttcattggaactatgggtctttcctttgcatggatgttctttgatacaaagccaagtg 10388746  T
211 aagaagaacttcttatgggtacaaatttagcaca 244  Q
    ||||||||||||||||||||||||||||| ||||    
10388747 aagaagaacttcttatgggtacaaatttatcaca 10388780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 10388552 - 10388588
Alignment:
16 ataaattaaaggatggtgaaaatgaatgaatgatata 52  Q
    |||||||||||||||||||||||||||||||||||||    
10388552 ataaattaaaggatggtgaaaatgaatgaatgatata 10388588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 281
Target Start/End: Original strand, 10388795 - 10388837
Alignment:
239 agcacatacatttttataaacttatttcccatgaagcgcacac 281  Q
    ||||||||||||||||||||||||||| | |||||||||||||    
10388795 agcacatacatttttataaacttattttcaatgaagcgcacac 10388837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University