View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_high_96 (Length: 250)
Name: NF18317_high_96
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_high_96 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 16 - 182
Target Start/End: Original strand, 39853091 - 39853249
Alignment:
| Q |
16 |
ctatcttgataaatcagggacatcactaacaacagttgtaggcaaatcctatttt-ttgctatctttgcccacctcttcaagatatagtacttgggcatt |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39853091 |
ctatcttgataaagcagggacatcactaacaacagttgtaggcaaatcctgtttttttgctatctttgtccacctcttcaagatatagtacttgggcatt |
39853190 |
T |
 |
| Q |
115 |
gatttaatatccatatgaataaacaacgaagtataccgaaactctcaaacttacaacaggagcaacaa |
182 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39853191 |
gatttaa---------gaataaacaacgaagtataccgaaactctcaaacttacgacaggagcaacaa |
39853249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 183 - 243
Target Start/End: Original strand, 39853279 - 39853339
Alignment:
| Q |
183 |
ttgccagtttccactctcctcgatcccttgccatggaaataacaaaatcaaatgatgatgt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39853279 |
ttgccagtttccactctcctcgatcccttgccatggaaataacaaaatcaaatgatgatgt |
39853339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 243
Target Start/End: Original strand, 32447882 - 32447915
Alignment:
| Q |
210 |
ttgccatggaaataacaaaatcaaatgatgatgt |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
32447882 |
ttgccatggaaataacaaaatcaaatggtgatgt |
32447915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University