View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_high_98 (Length: 247)
Name: NF18317_high_98
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_high_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 8844936 - 8845167
Alignment:
| Q |
1 |
tctcaaagttttgaatggagatgaagtggctcttttgtgactccgtgcccccggactctcccaacaataggaaatggcattgaaatccatagccaattaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8844936 |
tctcaaagttttaaatggagatgaagtggctcttttgtgacttcgtgcccccggactctcccaacgataggaaatgggtttgaaatccatagccaattaa |
8845035 |
T |
 |
| Q |
101 |
aaac-ttgtagtaaatggagctagcggattcaagtcatagcgtcgcatttaatttttaatggagttggcaatttgatctaagtaagacgaccacatcaac |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8845036 |
aaaccttgtagtaaatggagctagcggattcaagtcatagcgtggcatttaatttttaatggagttggcaatttgatctaagtaagacgaccacatcaac |
8845135 |
T |
 |
| Q |
200 |
aacttccattaggaaaggttaaccgatcaatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8845136 |
aacttccattaggaaaggttaaccgatcaatt |
8845167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University