View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_107 (Length: 238)
Name: NF18317_low_107
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_107 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 115 - 232
Target Start/End: Complemental strand, 1273683 - 1273566
Alignment:
| Q |
115 |
ttttgttggatacgtatgagatattttacggatatacacaaacacttattttaagattgatggatgacacgaaaaaaggcatgatatgattgtagtatat |
214 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
1273683 |
ttttattggatacgtatgagatactttacggatatacacaaacacttattttaagattgatggatgacacaaaaaaaggcaagatatgattgtagtatat |
1273584 |
T |
|
| Q |
215 |
caatggatatgtataaga |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1273583 |
caatggatatgtataaga |
1273566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University