View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_109 (Length: 236)
Name: NF18317_low_109
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_109 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 26661667 - 26661443
Alignment:
| Q |
16 |
attttcaaaaagaacaccaatttccagagagattgaattcaaaattgcatgtacctagctgtgaaaccctatgacctatacctttctctttgcattaaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26661667 |
attttcaaaaagaacaccaatttccagagagattgaattcaaaattgtatgtacctagctgtgaaaccctatgacctatccctttctctttgcattaaat |
26661568 |
T |
 |
| Q |
116 |
gccccacatgattcctttagtttaatttagtcttctgttccgaggaggaagcttatcttcctctattg----aattaattaattggaaatgaatattaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26661567 |
gccccacatgattcctttagtttaatttagtcttctgttccgaggaggaagcttatcttcctctattgatcaaattaattaattggaaatgaatattaat |
26661468 |
T |
 |
| Q |
212 |
nnnnnnncatgcatatgactttggc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26661467 |
aaaaaaacatgcatatgactttggc |
26661443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University