View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_112 (Length: 235)
Name: NF18317_low_112
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_112 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 34849184 - 34848970
Alignment:
| Q |
8 |
atttgtcatagaacaaataagtctctgtacatcgaaaaccaatttgtttcttctaagcatatttggaactcttaacacaccccttatggctaagattgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34849184 |
atttgtcatagaacaaataagtctctatacatcgaaaaccaatttgtttcctctaagcatatttggaactcttaacacaccccttatagctaagattgac |
34849085 |
T |
 |
| Q |
108 |
tatttcaagcatgactcaagtgatcttagagtgatcgggtaaattttttataggctttagtgttattttagaatttgggttgttcctaatccaacaatca |
207 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34849084 |
tatctcaagcatgactcaagtgatcttagagtcatcgggtaaattttttataggctttaatgttattttagaatttgagttgttcctaatccaacaatca |
34848985 |
T |
 |
| Q |
208 |
taaaaagaagatttt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34848984 |
taaaaagaagatttt |
34848970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University