View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_114 (Length: 234)
Name: NF18317_low_114
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_114 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 234
Target Start/End: Original strand, 47657691 - 47657911
Alignment:
| Q |
14 |
aaaacaatggatgttaatacttatgatgaaatttttgctggaatgacgaatccaaaacaccacgaaaaggtgaagggaattttggtttctctatgtaacg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47657691 |
aaaacaatggatgttaatacttatgatgaaatttttgctggaatgacgaatccaaaacaccacgaaaaggtgaagggaattttggtttctctatgtaacg |
47657790 |
T |
|
| Q |
114 |
gtgctgttgagactttggttaaaacatctcatcgggttttgactaatccaaaaggtaaatctgatttgagttcacctagggaaaacgagcgtttgaaacc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
47657791 |
gtgctgttgagactttggttaaaacatctcatcaggttttgactaatccaaaaggtaaatctgatttgagttcacctagggaaaacgggcttttgaaacc |
47657890 |
T |
|
| Q |
214 |
ggaagcttatcttcagaaatt |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47657891 |
ggaagcttatcttcagaaatt |
47657911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University