View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_117 (Length: 229)
Name: NF18317_low_117
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_117 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 3640041 - 3640246
Alignment:
| Q |
17 |
gatggtaatattggaaatgcattggttaacatgtatgttaagtgtggtgatatgaaaatggggttgaaggtttttaacatggttgttcataaagatgtta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640041 |
gatggtaatattggaaatgcattggttaacatgtatgttaagtgtggtgatatgaaaatggggttgaaggtttttaacatggttgttcataaagatgtta |
3640140 |
T |
|
| Q |
117 |
tttcttggggtactgttatttgtggattggctatgaatgggtatggtaaacaagttgtgcagatgttttcacatatgctggttcatggggttttacctga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640141 |
tttcttggggtactgttatttgtggattggctatgaatgggtatggtaaacaagttgtgcagatgttttcacatatgctggttcatggggttttacctga |
3640240 |
T |
|
| Q |
217 |
tgatgt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
3640241 |
tgatgt |
3640246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University