View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_121 (Length: 222)
Name: NF18317_low_121
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_121 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 4004863 - 4005048
Alignment:
| Q |
1 |
accaccacagcactattgctcctcttcactatctacttctattgtattctaatttctatgtatgtttgccatgatttggttgaaacatcaaagtgtaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4004863 |
accaccacagcactattgctcctcttcactatctacttctattgcattctcatttctatgtatgtttgccatgatttggttgaaacttcaaagtgtaatt |
4004962 |
T |
 |
| Q |
101 |
tttgcaaaattatgatagctctttgtacttccatagatccaaacatgcacttggacactctaccattgtcaccaaacaccctccac |
186 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4004963 |
tttgcaaaattatgatagctccttgtgcttccatagatccaaacatgcacttggacactctaccattgtcaccaaacaccctccac |
4005048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University