View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_122 (Length: 221)
Name: NF18317_low_122
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 6282276 - 6282462
Alignment:
| Q |
20 |
tctaagatgtgaatcgatgcctattattcgtttgaaggaaccaaccttgatgagtgagcaggtgtggctgagtgataaaaaatactatcaaattttatga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6282276 |
tctaagatgtgaatcgatgcctattattcgtttgaaggaaccaaccttgatgagtgagcaggtgtggctgagtgataaaaaa---tatcaaattttatga |
6282372 |
T |
 |
| Q |
120 |
tcataagc-aacacacgttcacaataagttttacttctccttccnnnnnnntaataattaa--ttattactttttcatatgaagcctttg |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
6282373 |
tcataagcaaacacacgttcacaataagttttacttctccttccaaaaaaataataattaatttttttactttttcatataaagcctttg |
6282462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University