View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_54 (Length: 338)
Name: NF18317_low_54
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 9 - 323
Target Start/End: Original strand, 34247463 - 34247777
Alignment:
| Q |
9 |
gacatcatcagcattctcatcactacaataaagacaaggatgttgcacaaatccttgtccttttagaacatccctagcctttaccacaacctctctatta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34247463 |
gacatcatcagcattctcatcactacaataaagacaaggatgttgcacaaatccttgtccttttagaacatccctagccttcaccacaacctctctatta |
34247562 |
T |
 |
| Q |
109 |
cttaatttcgccttattttccttcaacacaatctgaacagcattgctaaatgcaccataagcttttccattactcatatttggactcatatctgcagatg |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34247563 |
cttaatttccccttattttccttcaacacaatctgaacagcattgctaaatgcaccataagcttttccattactcatatttggactcatatctgcagatg |
34247662 |
T |
 |
| Q |
209 |
tctcatcagattgacagccactcaacagaatcccttcatccggtttcaacagaactccttcttcaagatcgcatgacgtaagccgaaacctcaaacttgc |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34247663 |
tctcatcagattgacaaccactcaacagaatcccttcatccggtttcaacagaactccttcttcaagatcgcgtgacgtaagccgaaacctcaaacttgc |
34247762 |
T |
 |
| Q |
309 |
atccgagccgaaaaa |
323 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34247763 |
atccgagccgaaaaa |
34247777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University